Focal Dermal Hypoplasia - Diagnostic Tests

Diagnostic Tools

This section offers to professional users instruments helpful to establish the disease diagnosis. Specific entries include:

  1. model questionnaires, protocols, or checklists, which may guide clinicians and laboratory personnel in the diagnostic procedure of specific disease groups/subgroups;
  2. a list of cell biology/biochemical tools used for laboratory diagnosis of specific diseases or group of diseases;
  3. a list of molecular genetics tools, including mutational screening procedures, oligonucleotide primer sequences, PCR amplification conditions, and other details for selected diseases. In this section, you also find the link for the gene-specific page of the Weizmann Institute of Science GeneCards website (http://www.genecards.org) which is an integrated database including information on disease relationships, SNPs, gene expression, gene function and more.
  4. a mutation database with a GENESKIN updated list of the mutations identified in the genes responsible for selected diseases. A link with the gene-specific page at the Human Gene Mutation Database maintained at the University of Wales in Cardiff (www.hgmd.org) and other databases, such as the collagen database in Leicester (www.le.ac.uk/genetics/collagen), is also available.

Model Questionnaire

Ectodermal Dysplasia Questionnaire

Cell Biology Tools

To date, there isn’t any cell biology or biochemical diagnostic test for this condition.

Molecular Genetic Tools

Causative genes

PORCN Genecards Logo

PORCN Genomic Primers

X2F AGTGCCAGAGTGCATCCTTT
X2R GGGTAAGGTGTGGCTCGATA
PRODUCT SIZE: 329

X3F AGGTCATCCTCCCCTTCCTA
X3R CATGCACTTCAGCCAACAGT
PRODUCT SIZE: 388

X4F CTCAGAGGCCATGAGTGTCA
X4R CAGGTGAGGGAGAAAAGCAG
PRODUCT SIZE: 200

X5F CCCACCTATCCATCCTTGTG
X5R GGCAGCTCTGTAGGGATCAA
PRODUCT SIZE: 385

X6F ACTGGTGAGGTCCTGAGTGG
X6R AGGCTCAGAACTGGGGAAAC
PRODUCT SIZE: 294

X7F CAATGAGGGGGTTGGGTAG
X7R GACGGTCAGACACACTTGGA
PRODUCT SIZE: 205

X8F TTTCTTCTCTGCTGCCTTCC
X8R AGAGGCATCACGTTCAGGTC
PRODUCT SIZE: 129

X9F GGGTATCATGTTGGGACCTG
X9R GACCGCCACACTTCTGTCTT
PRODUCT SIZE: 294

X10F AACGGCCAAGACAGAAGTGT
X10R TGCCTAGCACACAGAAGGTG
PRODUCT SIZE: 271

X11F TTTGGGCATGTGAAGTTTGA
X11R CTGGGGGAATGCAGATGACA

X12F TACATGTGAGCAGGGTGGAG
X12R CCCACCAACCTTCTATCCAA
PRODUCT SIZE: 210

X13F AGCCGTTGGATAGAAGGTTG
X13R CAGGCACCAAAAGAAGAAGG
PRODUCT SIZE: 283

X14F TCAGTCCTGGAACCCACTGT
X14R CAGCCTTTGTCCTCATGGTT
PRODUCT SIZE: 301

X15F TCGCCTAGAGCAGTCACAGA
X15R GGAGGGGGTCAAGGAGTAGA
PRODUCT SIZE: 304

Mutation Database

Causative genes

PORCN HGMD Logo